blasticidin resistance gene in lentisamv2 (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
blasticidin resistance gene in lentisamv2
Blasticidin Resistance Gene In Lentisamv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentisamv2/lentiSAMv2+(Plasmid+%2375112)/bio_rxiv__64898__2026__03__01__708923-175-1-11
Average 95 stars, based on 94 article reviews
Blasticidin Resistance Gene In Lentisamv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentisamv2/lentiSAMv2+(Plasmid+%2375112)/bio_rxiv__64898__2026__03__01__708923-175-1-11
Average 95 stars, based on 94 article reviews
blasticidin resistance gene in lentisamv2 - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: BPTF regulates androgen receptor activity by enhancing chromatin accessibility and stabilizing the AR-FOXA1 interaction. Article Snippet: Flag-FOXA1 was a gift from Stefan Koch (Addgene plasmid # 153109), and HA-FOXA1 was cloned into pcDNA3.1 vector. .. LentiMPHv2 (Addgene plasmid # 89308) and Article Title: Genome-wide interaction study with body mass index identifies CYP7A1 and GIPR as genetic modulators of metabolic dysfunction-associated steatotic liver disease Article Snippet: .. Guide RNA design and cloning To target the CYP7A1 locus, 3 single-guide RNAs (sgRNAs) were designed using Benchling and used alongside negative control guides targeting the safe-harbour AAVS1 locus26 and EGFP (guide sequences provided in Supplementary Table 10).27 Oligos were synthesised by Invitrogen and cloned following the Zhang lab protocol.27,28 Briefly, each set of guides was annealed and phosphorylated using T4 PNK (New England Biolabs, M0201), and then ligated into the Article Title: BPTF regulates androgen receptor activity by enhancing chromatin accessibility and stabilizing the AR-FOXA1 interaction Article Snippet: Flag-FOXA1 was a gift from Stefan Koch (Addgene plasmid # 153109), and HA-FOXA1 was cloned into pcDNA3.1 vector. .. LentiMPHv2 (Addgene plasmid # 89308) and Cloning:Article Title: Genome-wide interaction study with body mass index identifies CYP7A1 and GIPR as genetic modulators of metabolic dysfunction-associated steatotic liver disease Article Snippet: .. Guide RNA design and cloning To target the CYP7A1 locus, 3 single-guide RNAs (sgRNAs) were designed using Benchling and used alongside negative control guides targeting the safe-harbour AAVS1 locus26 and EGFP (guide sequences provided in Supplementary Table 10).27 Oligos were synthesised by Invitrogen and cloned following the Zhang lab protocol.27,28 Briefly, each set of guides was annealed and phosphorylated using T4 PNK (New England Biolabs, M0201), and then ligated into the Negative Control:Article Title: Genome-wide interaction study with body mass index identifies CYP7A1 and GIPR as genetic modulators of metabolic dysfunction-associated steatotic liver disease Article Snippet: .. Guide RNA design and cloning To target the CYP7A1 locus, 3 single-guide RNAs (sgRNAs) were designed using Benchling and used alongside negative control guides targeting the safe-harbour AAVS1 locus26 and EGFP (guide sequences provided in Supplementary Table 10).27 Oligos were synthesised by Invitrogen and cloned following the Zhang lab protocol.27,28 Briefly, each set of guides was annealed and phosphorylated using T4 PNK (New England Biolabs, M0201), and then ligated into the Clone Assay:Article Title: Genome-wide interaction study with body mass index identifies CYP7A1 and GIPR as genetic modulators of metabolic dysfunction-associated steatotic liver disease Article Snippet: .. Guide RNA design and cloning To target the CYP7A1 locus, 3 single-guide RNAs (sgRNAs) were designed using Benchling and used alongside negative control guides targeting the safe-harbour AAVS1 locus26 and EGFP (guide sequences provided in Supplementary Table 10).27 Oligos were synthesised by Invitrogen and cloned following the Zhang lab protocol.27,28 Briefly, each set of guides was annealed and phosphorylated using T4 PNK (New England Biolabs, M0201), and then ligated into the Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition Article Snippet: .. The PRDM16 guide RNA (5′-GCAATCTGACACCCCTCGCCG-3′) was cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site Article Snippet: .. For CRISPRa, gRNAs were cloned into Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition. Article Snippet: .. The PRDM16 guide RNA (5′GCAATCTGACACCCCTCGCCG3′) was cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site. Article Snippet: .. For CRISPRa, gRNAs were cloned into Transduction:Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition Article Snippet: .. The PRDM16 guide RNA (5′-GCAATCTGACACCCCTCGCCG-3′) was cloned into Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition. Article Snippet: .. The PRDM16 guide RNA (5′GCAATCTGACACCCCTCGCCG3′) was cloned into Selection:Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition Article Snippet: .. The PRDM16 guide RNA (5′-GCAATCTGACACCCCTCGCCG-3′) was cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site Article Snippet: .. For CRISPRa, gRNAs were cloned into Article Title: PRDM16 regulates smooth muscle cell identity and atherosclerotic plaque composition. Article Snippet: .. The PRDM16 guide RNA (5′GCAATCTGACACCCCTCGCCG3′) was cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site. Article Snippet: .. For CRISPRa, gRNAs were cloned into Marker:Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site Article Snippet: .. For CRISPRa, gRNAs were cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site. Article Snippet: .. For CRISPRa, gRNAs were cloned into Binding Assay:Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site Article Snippet: .. For CRISPRa, gRNAs were cloned into Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site. Article Snippet: .. For CRISPRa, gRNAs were cloned into Activation Assay:Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site Article Snippet: .. For CRISPRa, gRNAs were cloned into Article Title: A methyl-to-acetyl switch in H3K27 drives metabolic reprogramming and resistance to BRAF V600E inhibition in melanoma Article Snippet: Gene knockout (KO) was achieved using lentiCRISPRv2GFP (Addgene #82416), with gRNAs targeting BRD4 and KDM6A designed via CHOPCHOP ( https://chopchop.cbu.uib.no/ ) and cloned per Addgene protocol. .. For CRISPR activation (CRISPRa), Article Title: HIV-1 transcription dominates over host gene activity at the HIV-1 integration site. Article Snippet: .. For CRISPRa, gRNAs were cloned into CRISPR:Article Title: A methyl-to-acetyl switch in H3K27 drives metabolic reprogramming and resistance to BRAF V600E inhibition in melanoma Article Snippet: Gene knockout (KO) was achieved using lentiCRISPRv2GFP (Addgene #82416), with gRNAs targeting BRD4 and KDM6A designed via CHOPCHOP ( https://chopchop.cbu.uib.no/ ) and cloned per Addgene protocol. .. For CRISPR activation (CRISPRa), |
